Páginas Navegación Menú

Blog de Mme García Senín

1ºBachiBac · 1ère S

LOS ÁCIDOS NUCLEICOS

Escrito por el 17 agosto, 2014 en 1º BACHIBAC - BIOLOGÍA | 0 comentarios

Aunque parezca raro, lo que llamamos información Genética, genoma, libro de la vida…está escrito con cuatro letras: A, C, T, G. Las mismas letras para Todos los seres vivos. Los genes, son palabras larguísimas escritas con esas cuatro letras.

Un gen significa una función, una característica, y ésta, normalmente, se debe a una proteína, responsable, directa o indirectamente, de esa característica o de esa función. Pero, ¿cómo la información genética se traduce en una proteína?

El mecanismo es complejo, pero lo más llamativo es que el mecanismo para decodificar la información genética contenida en un gen, que determina la síntesis de una proteína con una secuencia de aminoácidos concreta, es común para todos los seres vivos. Por eso, si consiguiéramos insertar un gen humano en otro ser vivo, aunque fuera unicelular, al reproducirse ese ser vivo, transmitiría con su información genética ese gen a su descendencia. Incluso, hasta podría fabricar esa proteína si lo cultiváramos en un medio de cultivo adecuado, y hasta podríamos obtener purificada esa proteína para usarla como tratamiento de enfermedades, por ejemplo. Estamos hablando de ingeniería genética y biotecnología, así se obtienen proteínas como enzimas, factores de coagulación, insulina, hormona del crecimiento…

 Los ácidos nucleicos

 Son unas biomoléculas orgánicas formadas por carbono, hidrógeno, oxígeno, nitrógeno y fósforo, se localizan tanto en el núcleo como en el citoplasma de la célula. Tienen una gran trascendencia, ya que el ADN contiene la información genética y dirige el funcionamiento celular. El ARN es imprescindible para que la célula pueda fabricar sus proteínas con la información contenida en los genes.

Los ácidos nucleicos son polímeros de nucleótidos. El ADN es un polímero dedesoxirribonucleótidos y el ARN es un polímero de ribonucleótidos. Existen cuatro tipos de desoxirribonucleótidos (adenina, guanina, timina y citosina) y cuatro tipos de ribonucleótidos (adenina, guanina, timina y uracilo). Como ves, es la base nitrogenada la que determina el tipo de ribonucleótido o desoxirribonucleótido del que se trata. Por ello la información de los ácidos nucleicos se localiza en su secuencia de bases nitrogenadas.

BASES NITROGENADAS

 EL ADN

El ADN se encuentra en el núcleo de la célula. Una molécula de ADN contiene información para muchos caracteres, cada una de estas informaciones se encuentra en un gen, en general los genes codifican proteínas, siendo la proteína la responsable de la manifestación del carácter. Lo que determina el gen, es la secuencia de aminoácidos de la proteína que codifica, por eso afirmamos que las proteínas son los productos de la expresión de los genes.

Según el modelo de Watson y Crick (1953) la molécula de ADN, está formada por dos cadenas de desoxirribonucleótidos, complementarias y antiparalelas, que forman una doble hélice. Cada una de las dos cadenas tiene su secuencia de bases nitrogenadas, pero sólo una de ellas contiene información genética.

4º ADN - Fragmento plano molécula con nombres cadenaadn.preview

Este modelo permite comprender la estructura del ADN, así como su funcionamiento, esto es, como se puede expresar la información que contiene y como se puede duplicar dicha información; lo primero es muy importante para entender como se sintetiza una proteína utilizando la información contenida en un gen; lo segundo es esencial para la reproducción celular, ya que antes de dividirse la célula ha de duplicar su información genética, para repartirla entre las células hijas.

Es evidente que solo una de las cadenas puede llevar información, ya que la otra es complementaria y su secuencia depende de la primera. A la cadena que lleva información la denominamos cadena con sentido.

¿Qué se puede hacer con la información contenida en el ADN?

La información contenida en el ADN se puede transmitir a la descendencia, también puede ser utilizada para fabricar proteínas.

Antes de la división celular: duplicación del ADN

Antes de reproducirse, la célula tiene que duplicar su información genética, a continuación, la reparte entre las células hijas. Hablamos de duplicación o replicación del ADN cuando a partir de una molécula de ADN, se forman dos moléculas idénticas. El mecanismo de duplicación se basa en la complementariedad de las bases nitrogenadas, y a grandes rasgos consiste en lo siguiente:

Las dos cadenas complementarias de una molécula de ADN se empiezan a separar, de tal manera que las bases nitrogenadas que antes estaban en frentadas y unidas mediante puentes de hidrógeno, ahora quedan libres y se les pueden unir desoxirribonucleótidos complementarios presentes en el medio en el que se está produciendo la duplicación. Estos desoxirribonucleótidos son polimerizados por un enzima especial, denominado ADN polimerasa. De tal manera que, en un proceso en el que una cadena actúa como molde, se origina, por polimerización de desoxirribonucleótidos la otra cadena. El proceso de duplicación del ADN afecta a toda la información genética, es decir, cuando se duplica el ADN lo hace todo el ADN celular, siempre antes de la división de la célula.

Véase aquí una web con una animación muy bien explicada.

Para fabricar una proteína: transcripción de un gen, traducción del ARN mensajero

Por transcripción de un gen se origina una molécula de ARN. Si el gen que se transcribe codifica una proteína, el ARN que se obtiene se denomina ARN mensajero. El gen que contiene información para fabricar una proteína está encadenado a otros cientos de genes, la información genética está en el núcleo; las proteínas se fabrican en los ribosomas, que están en el citoplasma; el gen no puede salir del núcleo arrastrando consigo a los demás genes que le acompañan en la molécula de ADN. Se hace necesario fabricar otra molécula que, con la misma información del gen, pueda salir del núcleo para dirigir la síntesis de la proteína en el citoplasma, esta molécula es el ARN mensajero y, para su síntesis ocurre lo siguiente:

En la zona en la que se encuentra el gen la cromatina se relaja lo suficiente como para que se puedan separar las dos cadenas de la molécula de ADN. A continuación se unen ribonucleótidos, por complementariedad a las bases nitrogenadas de la cadena con sentido del gen; un enzima, ARN polimerasa, une los ribonucleótidos entre sí. Así se forma una molécula de ARN que porta la misma información que el gen. El proceso se basa en la complementariedad de las bases nitrogenadas (a la A de la cadena con sentido del gen se le une el U, a la T la A, a la C la G y a la G la C). Las secuencias de la cadena con sentido del gen y la del ARN mensajero no son iguales, son complementarias. Las dos moléculas llevan la misma información, es como un negativo y su correspondiente fotografía,evidentemente son diferentes, pero portan la misma imagen.

En la siguiente web podeis ver una animación de la Transcripción:

Otros tipos de ARN son: el ARN ribosómico, que forma parte de los ribosomas, tiene función estructural; y el ARN transferente, cuya misión es transportar aminoácidos para el proceso desíntesis de proteínas. Durante ese proceso los ARNt unidos a su correspondiente aminoácido se van a unir al ARN mensajero, determinándose así el orden de colocación de los aminoácidos.

arnm

Información extra:

Aquí les dejo dos imágines donde se observa el lugar dónde podemos encontrar ADN-ARn así como los tipos de ARN-ADN existentes.

TIPOS Y DONDE DONDE

La traducción o síntesis de proteínas

Este proceso consiste simplemente en polimerizar aminoácidos en un orden determinado (secuencia de aminoácidos), para ello tienen que colocarse en el orden correspondiente y ser unidos por un enzima, formándose, a continuación el enlace peptídico. El proceso tiene lugar, en el citoplasma celular. Para ello es necesario que los distintos tipos de ARN transferente existentes (61 tipos), lleven unido el aminoácido que le corresponde.

gen proteina codigo genetico

La información necesaria para fabricar la proteína la lleva ahora el ARN mensajero, de cuya secuencia se va a “deducir” el orden en el que se tienen que polimerizar los aminoácidos durante la síntesis de la proteína. La información del ARN mensajero se encuentra en sus tripletes de bases nitrogenadas (codones), de los sesenta y cuatro codones posibles, sesenta y uno determinan la polimerización de algún aminoácido, pero tres lo que marcan es el final de la síntesis de la proteína (son los tres codones de finalización). Por lo tanto, un codón es un triplete de bases nitrogenadas de un ARN mensajero que determinan la polimerización de un aminoácido durante la síntesis de proteínas. El primer codón que se traduce durante el proceso, es el codón de iniciación (AUG) que determina al aminoácido metionina. El último codón que se traduce es el anterior a uno de terminación.

¿Por qué el codón AUG determina la polimerización de la metionina? Porque durante la traducción,a ese codón se le une el transferente que transporta a la metionina. Este mismo razonamiento sirve para relacionar cualquier codón del mensajero con el aminoácido que le corresponde.

En la siguiente web podeis ver una animación de la traducción o síntesis de proteinas:

El español Severo Ochoa tuvo un papel relevante en la deducción de la relación existente entre los sesenta y cuatro codones del ARN mensajero y lo que especificaban en la síntesis de proteínas. Junto a otros científicos ayudó a deducir la clave genética, tabla en la que aparecen los sesenta y cuatro codones y su significado en la síntesis de proteínas. Sus aportaciones le valieron el premio Nóbel en 1959.

Si se produce una mutación en un gen, ¿cuáles son las consecuencias?

Es importante entender que la secuencia de aminoácidos de una proteína depende de la secuencia de ribonucleótidos del ARN mensajero que dirige el proceso de traducción, y que ésta depende de la secuencia de desoxirribonucleótidos del gen que codifica la proteína. Por todo estos es evidente que si se produce una mutación en el gen, cuando se transcriba dará lugar a un ARN mensajero diferente, en el que variará al menos un codón, por lo que al traducirse dicho ARN mensajero, lo normal será que cambie un aminoácido por otro, lo que de alguna manera afectará a la estructura de la proteína. Por este motivo, en la mayoría de los casos, las mutaciones provocan la síntesis de una proteína inútil, o menos eficaz de lo que correspondería. A veces, por el contrario la proteína sigue siendo igual, o incluso más eficaz, por este motivo debemos considerar a la mutación una fuente de variabilidad capaz de generar nuevos alelos, que pueden ser seleccionados o rechazados por la selección natural. Debe quedar claro que la mutación puede tener otras consecuencias, entre las más importantes caben las que se relacionan con la regulación de la división celular (se pueden generar tumores) y con la regulación de la expresión de genes (mutaciones que afectan a genes reguladores).

Ejercicios de repaso:

1.Representa la secuencia completa de este ADN: TCGTTCGACCTGTCTTAAGTTA

2.Sabiendo que la secuencia del ejercicio anterior es la cadena con sentido de un gen obtén el ARN correspondiente en el proceso de transcripción.

3.Utilizando la clave genética, traduce esta molécula de ARNm:

CGGCUAAAUGGCGUCACCGUUACAGGUGAAAUUUUGAGCUACCGU.

4.Explica el proceso de duplicación del ADN. ¿Qué utilidad tiene?

5.Explica el proceso de transcripción de un gen. ¿

En que casos se produce?

6.Explica las consecuencias que puede tener la mutación de un gen.

7.¿Qué es un codón? ¿Qué determina? ¿Por qué?

8.¿Qué es un codón de terminación? ¿Cuáles son los codones de terminación? ¿Por qué determinan el final de la traducción?

Ejercicios extras:

ejercicios extra 1 extra 2

Recomendación:

Recomiendo encarecidamente como complemento  a toda esta información el vídeo del Genema Humado que podeis ver aquí.